BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg930212 Length=2362 Score E Sequences producing significant alignments: (Bits) Value AT3G22320.1 | Symbols: ATRPABC24.3, RPB5A, NRPB5, NRPD5 | Eukar... 56.5 1e-06 > AT3G22320.1 | Symbols: ATRPABC24.3, RPB5A, NRPB5, NRPD5 | Eukaryotic rpb5 RNA polymerase subunit family protein | chr3:7890864-7892347 REVERSE LENGTH=942 Length=942 Score = 56.5 bits (30), Expect = 1e-06 Identities = 30/30 (100%), Gaps = 0/30 (0%) Strand=Plus/Plus Query 2305 CTGGAGAGATACACAGTGAAGGAGACACAG 2334 |||||||||||||||||||||||||||||| Sbjct 606 CTGGAGAGATACACAGTGAAGGAGACACAG 635 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 117268473120 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5