BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg930434 Length=215 Score E Sequences producing significant alignments: (Bits) Value AT3G23900.1 | Symbols: | RNA recognition motif (RRM)-containin... 89.8 9e-18 > AT3G23900.1 | Symbols: | RNA recognition motif (RRM)-containing protein | chr3:8631606-8636045 REVERSE LENGTH=3417 Length=3417 Score = 89.8 bits (48), Expect = 9e-18 Identities = 55/58 (95%), Gaps = 2/58 (3%) Strand=Plus/Minus Query 113 ATCAGGTCTCAGTTTCCTACTTATCTCTCTGCAGCTCTAGCTGCTGCAAGCTCATTGG 170 |||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| Sbjct 1675 ATCAGGTCTCAGTTTCCTACTTATCTCT--GCAGCTCTAGCTGCTGCAAGCTCAGTGG 1620 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9601140059 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5