BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg930570 Length=449 Score E Sequences producing significant alignments: (Bits) Value AT3G22730.1 | Symbols: | F-box and associated interaction doma... 76.8 2e-13 AT3G22700.1 | Symbols: | F-box and associated interaction doma... 69.4 3e-11 > AT3G22730.1 | Symbols: | F-box and associated interaction domains-containing protein | chr3:8031341-8032459 REVERSE LENGTH=1119 Length=1119 Score = 76.8 bits (41), Expect = 2e-13 Identities = 87/109 (80%), Gaps = 4/109 (4%) Strand=Plus/Plus Query 27 GATCATCTCTGATCTTCCGTGGGATTTGGTAGAGGAAATACTCTCTAGGACTTTGATA-A 85 ||| || || |||||| | | |||||||||||||||||||||||||||| || | | Sbjct 3 GATGATGTCCGATCTTTCTTTGGATTTGGTAGAGGAAATACTCTCTAGGG-TTCCAGCCA 61 Query 86 CTTCTCTCAGAGCGGTTG-GATCCACTTGCAAACGATGGAACACTTTAT 133 | ||||||| | || || |||| |||||||||| ||||||| |||||| Sbjct 62 CATCTCTCAAA-CGATTACGATCTACTTGCAAACTATGGAACGCTTTAT 109 > AT3G22700.1 | Symbols: | F-box and associated interaction domains-containing protein | chr3:8024798-8025814 REVERSE LENGTH=1017 Length=1017 Score = 69.4 bits (37), Expect = 3e-11 Identities = 83/105 (79%), Gaps = 4/105 (4%) Strand=Plus/Plus Query 38 ATCTTCCGTGGGATTTGGTAGAGGAAATACTCTCTAGGACTTTGATA-ACTTCTCTCAGA 96 ||||||| | |||||||||||||||||||||||||||| || | || ||||||| | Sbjct 8 ATCTTCCTTTGGATTTGGTAGAGGAAATACTCTCTAGGG-TTCCAGCCACATCTCTCAAA 66 Query 97 GCGGTTG-GATCCACTTGCAAACGATGGAACACTTTATCCAAAGA 140 || || |||| ||||| | || ||||||| |||||| ||||| Sbjct 67 -CGATTACGATCGACTTGTAGACAATGGAACGCTTTATTGAAAGA 110 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 21363793325 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5