BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg930636 Length=428 Score E Sequences producing significant alignments: (Bits) Value AT3G17490.1 | Symbols: | F-box and associated interaction doma... 52.8 3e-06 > AT3G17490.1 | Symbols: | F-box and associated interaction domains-containing protein | chr3:5984827-5985993 FORWARD LENGTH=1167 Length=1167 Score = 52.8 bits (28), Expect = 3e-06 Identities = 28/28 (100%), Gaps = 0/28 (0%) Strand=Plus/Plus Query 47 GGATTTGGTAGAGGAGATACTCTCTAGG 74 |||||||||||||||||||||||||||| Sbjct 24 GGATTTGGTAGAGGAGATACTCTCTAGG 51 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 20308170596 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5