BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg930665 Length=340 Score E Sequences producing significant alignments: (Bits) Value AT2G32235.1 | Symbols: | unknown protein; Has 38 Blast hits to... 93.5 1e-18 > AT2G32235.1 | Symbols: | unknown protein; Has 38 Blast hits to 38 proteins in 14 species: Archae - 0; Bacteria - 4; Metazoa - 11; Fungi - 11; Plants - 11; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | chr2:13682557-13685500 REVERSE LENGTH=2156 Length=2156 Score = 93.5 bits (50), Expect = 1e-18 Identities = 63/69 (91%), Gaps = 2/69 (3%) Strand=Plus/Plus Query 244 GATCTTCTCGCTCCAATGCAATTCCTGAAGCTGAGCTTGTGAATCCAGAAAGCTCTGCA- 302 |||||||||||||||||||||||||||||| ||| || | ||||||||||||||||| | Sbjct 1544 GATCTTCTCGCTCCAATGCAATTCCTGAAGGTGATCTCGCGAATCCAGAAAGCTCTG-AT 1602 Query 303 GCCAATAAG 311 ||||||||| Sbjct 1603 GCCAATAAG 1611 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 15884608684 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5