BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg930821 Length=422 Score E Sequences producing significant alignments: (Bits) Value AT3G01130.1 | Symbols: | unknown protein; FUNCTIONS IN: molecu... 139 2e-32 > AT3G01130.1 | Symbols: | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 64 Blast hits to 64 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:44045-45590 REVERSE LENGTH=659 Length=659 Score = 139 bits (75), Expect = 2e-32 Identities = 90/97 (93%), Gaps = 2/97 (2%) Strand=Plus/Plus Query 211 CTTTACTCCGGCACCAGCACTCTTGCTCTGGTTGCTCGTGCTTCGGCTTTTGGGTTGGTT 270 ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| | Sbjct 87 CTTTACTCCGGTACCAGCACTCTTGCTCTGGTTGCTCGTGCTTCGGCTTTCGGGTTGGGT 146 Query 271 CTTATCTATCG-CAACATCAAGCTCAAGGCTTTGAAG 306 || ||||| || ||||||||||||||||||||| ||| Sbjct 147 CTCATCTA-CGGCAACATCAAGCTCAAGGCTTTAAAG 182 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 20006564102 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5