BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg930994 Length=388 Score E Sequences producing significant alignments: (Bits) Value ATMG00516.1 | Symbols: NAD1C, NAD1 | NADH dehydrogenase 1C | ch... 110 1e-23 > ATMG00516.1 | Symbols: NAD1C, NAD1 | NADH dehydrogenase 1C | chrM:143219-147048 REVERSE LENGTH=318 Length=318 Score = 110 bits (59), Expect = 1e-23 Identities = 59/59 (100%), Gaps = 0/59 (0%) Strand=Plus/Plus Query 97 TCTTCAATGGGGTCTGCTCttttttttttGGGAGAGTATGCCAATATGATCTTAATGAG 155 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 260 TCTTCAATGGGGTCTGCTCTTTTTTTTTTGGGAGAGTATGCCAATATGATCTTAATGAG 318 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 18297460636 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5