BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg931039 Length=307 Score E Sequences producing significant alignments: (Bits) Value AT1G15120.2 | Symbols: | Ubiquinol-cytochrome C reductase hing... 80.5 8e-15 > AT1G15120.2 | Symbols: | Ubiquinol-cytochrome C reductase hinge protein | chr1:5202648-5204193 FORWARD LENGTH=744 Length=744 Score = 80.5 bits (43), Expect = 8e-15 Identities = 48/50 (96%), Gaps = 1/50 (2%) Strand=Plus/Plus Query 158 GTCTGCAGCTTCCGAATTGACTTTCAACATGGCAGATGATGAAGTTGTTG 207 |||| |||||||| |||||||||||||||||||||||||||||||||||| Sbjct 175 GTCTTCAGCTTCC-AATTGACTTTCAACATGGCAGATGATGAAGTTGTTG 223 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14225772967 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5