BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg931106 Length=395 Score E Sequences producing significant alignments: (Bits) Value AT1G71190.1 | Symbols: SAG18 | senescence associated gene 18 | ... 174 5e-43 > AT1G71190.1 | Symbols: SAG18 | senescence associated gene 18 | chr1:26833406-26835032 REVERSE LENGTH=1087 Length=1087 Score = 174 bits (94), Expect = 5e-43 Identities = 105/110 (95%), Gaps = 2/110 (2%) Strand=Plus/Plus Query 78 GAAAATAGGATGGACTTGCTTTTACATCGGTGT-GACTGCTGTTGCTTTTGGATCGTCTT 136 ||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |||| Sbjct 293 GAAAATAGGATGGACTTGCTTTTACATCGGTGTAG-CTGCTGTTGCTTTTGGATCTTCTT 351 Query 137 ACTATCATCTTCACCCAAATGATGCTGCTCTCCTCTGGGATCGTCTTCCC 186 ||||||||||||||||||| |||||| ||||||||||||||||||||||| Sbjct 352 ACTATCATCTTCACCCAAACGATGCTACTCTCCTCTGGGATCGTCTTCCC 401 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 18649334879 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5