BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg931160 Length=538 Score E Sequences producing significant alignments: (Bits) Value AT5G25300.1 | Symbols: | CONTAINS InterPro DOMAIN/s: F-box dom... 106 2e-22 > AT5G25300.1 | Symbols: | CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein with a domain of unknown function (DUF295) (TAIR:AT5G25290.1); Has 285 Blast hits to 224 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 282; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). | chr5:8780258-8783093 FORWARD LENGTH=1434 Length=1434 Score = 106 bits (57), Expect = 2e-22 Identities = 99/119 (83%), Gaps = 4/119 (3%) Strand=Plus/Plus Query 50 AGGGTTTCGATTTCTT-GCAAACTCGGGTAATTGGTTCCTT-GTGATAGATTCTTGTTCC 107 |||| ||||| ||||| |||||||| | ||| ||||| ||| ||| |||||||| ||||| Sbjct 135 AGGGATTCGA-TTCTTGGCAAACTCAGTTAACTGGTT-CTTGGTGCTAGATTCTCGTTCC 192 Query 108 AATCTCTATATCATAGATGTGTTCGGCAAGAATTTGATCGATCTACTGCCTCTAGAATC 166 ||||||||||||||||||||||| || |||| ||||||||| | || |||||||| Sbjct 193 AATCTCTATATCATAGATGTGTTTAGCGAGAAAAAGATCGATCTTCCACCCCTAGAATC 251 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 25770117411 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5