BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg931892 Length=292 Score E Sequences producing significant alignments: (Bits) Value AT1G01230.1 | Symbols: | ORMDL family protein | chr1:97456-992... 89.8 1e-17 > AT1G01230.1 | Symbols: | ORMDL family protein | chr1:97456-99240 FORWARD LENGTH=832 Length=832 Score = 89.8 bits (48), Expect = 1e-17 Identities = 50/51 (98%), Gaps = 0/51 (0%) Strand=Plus/Plus Query 7 GTTTTTCCCCTGGAATGGCTTGGACTGTTGTTAATCTCGCTCACTTCGTTG 57 ||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GTTGTTCCCCTGGAATGGCTTGGACTGTTGTTAATCTCGCTCACTTCGTTG 351 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 13471756732 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5