BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg932652 Length=719 Score E Sequences producing significant alignments: (Bits) Value AT1G30925.1 | Symbols: | phospholipase Cs | chr1:11009888-1101... 56.5 3e-07 > AT1G30925.1 | Symbols: | phospholipase Cs | chr1:11009888-11011792 REVERSE LENGTH=1125 Length=1125 Score = 56.5 bits (30), Expect = 3e-07 Identities = 30/30 (100%), Gaps = 0/30 (0%) Strand=Plus/Plus Query 206 TATGCATCAATGGGGTTTTATATTACTTAG 235 |||||||||||||||||||||||||||||| Sbjct 113 TATGCATCAATGGGGTTTTATATTACTTAG 142 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 34862498018 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5