BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg932655 Length=206 Score E Sequences producing significant alignments: (Bits) Value AT2G25220.2 | Symbols: | Protein kinase superfamily protein | ... 117 4e-26 > AT2G25220.2 | Symbols: | Protein kinase superfamily protein | chr2:10742713-10745594 REVERSE LENGTH=1573 Length=1573 Score = 117 bits (63), Expect = 4e-26 Identities = 65/66 (98%), Gaps = 0/66 (0%) Strand=Plus/Plus Query 102 TCTTCTTCTTCTGCTTCAAATCCTTCTTTAGCTCCTGTTTACTCTTCCATGGCTACATTC 161 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 73 TCTGCTTCTTCTGCTTCAAATCCTTCTTTAGCTCCTGTTTACTCTTCCATGGCTACATTC 132 Query 162 TCTCCT 167 |||||| Sbjct 133 TCTCCT 138 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9205147233 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5