BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg932872 Length=267 Score E Sequences producing significant alignments: (Bits) Value AT5G54430.1 | Symbols: ATPHOS32, PHOS32 | Adenine nucleotide al... 239 1e-62 > AT5G54430.1 | Symbols: ATPHOS32, PHOS32 | Adenine nucleotide alpha hydrolases-like superfamily protein | chr5:22097166-22099758 REVERSE LENGTH=1101 Length=1101 Score = 239 bits (129), Expect = 1e-62 Identities = 147/156 (94%), Gaps = 0/156 (0%) Strand=Plus/Plus Query 79 CCTCTCAGAACTCAAATTGAAGATCCAAACGCTCAGTCTCAGCCTAGTCAAGAGCATTTT 138 ||||| | ||||||||||||||||||||||||||| |||| |||||||||||| ||||| Sbjct 357 CCTCTGAAAACTCAAATTGAAGATCCAAACGCTCAACCTCAACCTAGTCAAGAGGATTTT 416 Query 139 GATGCTTTTACTTCAACCAAAGTTGCGGATCTAGCTAAGCCGTTGAAGGAATTAGGGTTT 198 ||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||| Sbjct 417 GATGCTTTTACTTCAACAAAAGTTGCGGATCTAGCTAAACCGTTGAAGGAGTTAGGGTTT 476 Query 199 CCTTATAAGATCCATATAGTGAAAGATCATGATATG 234 |||||||||||||||||||||||||||||||||||| Sbjct 477 CCTTATAAGATCCATATAGTGAAAGATCATGATATG 512 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12215063007 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5