BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg932977 Length=237 Score E Sequences producing significant alignments: (Bits) Value AT1G27750.1 | Symbols: | nucleic acid binding | chr1:9657385-9... 148 2e-35 > AT1G27750.1 | Symbols: | nucleic acid binding | chr1:9657385-9661958 FORWARD LENGTH=3476 Length=3476 Score = 148 bits (80), Expect = 2e-35 Identities = 100/109 (92%), Gaps = 3/109 (3%) Strand=Plus/Plus Query 132 GAATCTCAGCCTCCG---CCACCGCAATTAGAATCCCAATCCCCTTCTACGGTGGTTAGC 188 |||||||| |||||| ||||||||| |||||||||||||||||||||||||||| ||| Sbjct 95 GAATCTCACCCTCCGCCACCACCGCAACTAGAATCCCAATCCCCTTCTACGGTGGTAAGC 154 Query 189 TCGTTCCCAGCTCCGGTGACGCCGTAGCCTCCATCTCAGGAGGAAATTC 237 |||||||| ||||||||||| |||| ||||||||||||||||||||||| Sbjct 155 TCGTTCCCGGCTCCGGTGACACCGTCGCCTCCATCTCAGGAGGAAATTC 203 Score = 93.5 bits (50), Expect = 8e-19 Identities = 52/53 (98%), Gaps = 0/53 (0%) Strand=Plus/Plus Query 50 CTCTACGAATCTTGAGCAAGCGTATCGCTCCCTCATCTCCGCTTCCAGAGGTT 102 |||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 298 CTCTGCGAATCTTGAGCAAGCGTATCGCTCCCTCATCTCCGCTTCCAGAGGTT 350 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 10707030537 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5