BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg933064 Length=343 Score E Sequences producing significant alignments: (Bits) Value AT3G44110.1 | Symbols: ATJ3, ATJ | DNAJ homologue 3 | chr3:1586... 108 4e-23 > AT3G44110.1 | Symbols: ATJ3, ATJ | DNAJ homologue 3 | chr3:15868794-15871256 REVERSE LENGTH=1781 Length=1781 Score = 108 bits (58), Expect = 4e-23 Identities = 67/71 (94%), Gaps = 2/71 (3%) Strand=Plus/Plus Query 1 TGAGGAT-TGTACCTT-GAACAATGAAGAAGCTTTCACTTTCTAGGAATGCTCTCTGCTC 58 ||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||| Sbjct 584 TGAGGATGTGTACCTTGGTACAATGAAGAAGCTTTCACTTTCTAGGAATGCTCTCTGCTC 643 Query 59 AAAGTGTAACG 69 |||||||||| Sbjct 644 TAAGTGTAACG 654 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 16035411931 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5