BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg933899 Length=842 Score E Sequences producing significant alignments: (Bits) Value AT2G33190.1 | Symbols: | F-box family protein with a domain of... 67.6 2e-10 > AT2G33190.1 | Symbols: | F-box family protein with a domain of unknown function (DUF295) | chr2:14067972-14069111 FORWARD LENGTH=1140 Length=1140 Score = 67.6 bits (36), Expect = 2e-10 Identities = 38/39 (97%), Gaps = 0/39 (0%) Strand=Plus/Plus Query 696 TGCGGTGTATTCGATCTTGCGACAAGTACAATCACATGG 734 |||||||| |||||||||||||||||||||||||||||| Sbjct 1042 TGCGGTGTGTTCGATCTTGCGACAAGTACAATCACATGG 1080 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 41041298099 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5