BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg933952 Length=677 Score E Sequences producing significant alignments: (Bits) Value AT1G67455.1 | Symbols: | F-box and associated interaction doma... 56.5 3e-07 > AT1G67455.1 | Symbols: | F-box and associated interaction domains-containing protein | chr1:25268145-25269475 FORWARD LENGTH=651 Length=651 Score = 56.5 bits (30), Expect = 3e-07 Identities = 36/39 (92%), Gaps = 0/39 (0%) Strand=Plus/Plus Query 71 ACACTAGGCTCGTGGTTTGGAACCCGTATACGGGGCAAA 109 ||||||||||||||||||||||||||||| |||| ||| Sbjct 176 ACACTAGGCTCGTGGTTTGGAACCCGTATTTGGGGAAAA 214 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 32752663844 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5