BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg934125 Length=203 Score E Sequences producing significant alignments: (Bits) Value AT2G35160.1 | Symbols: SUVH5, SGD9 | SU(VAR)3-9 homolog 5 | chr... 110 7e-24 > AT2G35160.1 | Symbols: SUVH5, SGD9 | SU(VAR)3-9 homolog 5 | chr2:14822824-14826162 FORWARD LENGTH=2798 Length=2798 Score = 110 bits (59), Expect = 7e-24 Identities = 76/83 (92%), Gaps = 5/83 (6%) Strand=Plus/Minus Query 119 AAGGAATACTGATAATGGCGGAGATGACGACGAGTCGATTGGCCGGAGCGGGAGATATGT 178 ||||| || |||||||||||||||| ||||||||||||||||||||||||||||| | Sbjct 173 AAGGAGTAGTGATAATGGCGGAGAT---GACGAGTCGATTGGCCGGAGCGGGAGATA--T 119 Query 179 GTGAGTCGCCTACTCAAATTGGG 201 ||||||||||||||||||||||| Sbjct 118 GTGAGTCGCCTACTCAAATTGGG 96 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9054243180 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5