BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg934138 Length=244 Score E Sequences producing significant alignments: (Bits) Value AT2G35260.1 | Symbols: | unknown protein; FUNCTIONS IN: molecu... 169 1e-41 > AT2G35260.1 | Symbols: | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17840.1); Has 42 Blast hits to 42 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:14849536-14851969 FORWARD LENGTH=1623 Length=1623 Score = 169 bits (91), Expect = 1e-41 Identities = 97/100 (97%), Gaps = 0/100 (0%) Strand=Plus/Plus Query 120 GAATTGATTCATCTGGTGGATTTGATCCTTCTCTTGATGCACTACTTGCTGGACTTGGCT 179 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 519 GAATTGATTCATCTGGTGGATTTGATCCTTCTCTTGATGCACTACTTGCTGGACTTGGCT 578 Query 180 ATGCAACACCACCAATCATGGCTCTTCTCTCCGTTCTCGA 219 |||||||||||||||||||||||||||||| | | ||||| Sbjct 579 ATGCAACACCACCAATCATGGCTCTTCTCTTCATACTCGA 618 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 11058904780 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5