BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg934451 Length=202 Score E Sequences producing significant alignments: (Bits) Value AT2G36360.5 | Symbols: | Galactose oxidase/kelch repeat superf... 99.0 1e-20 > AT2G36360.5 | Symbols: | Galactose oxidase/kelch repeat superfamily protein | chr2:15243413-15247627 REVERSE LENGTH=1691 Length=1691 Score = 99.0 bits (53), Expect = 1e-20 Identities = 72/80 (90%), Gaps = 5/80 (6%) Strand=Plus/Plus Query 3 ATCATCGGCTGAATAAAAATGCATAACTGGGTTCAAGCTTCTTCTTCCGATTTCAGTGGA 62 |||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 91 ATCATCGGCT---T-AAAATGCATCACTGGGTTCAAGCTTCTTCTTCCGATTTCAGTGGA 146 Query 63 -CTCCTCCGCAGGCGCGGAG 81 |||||||||| || ||||| Sbjct 147 ACTCCTCCGCAAGCTCGGAG 166 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9003941829 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5