BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg934561 Length=216 Score E Sequences producing significant alignments: (Bits) Value AT2G38580.1 | Symbols: | Mitochondrial ATP synthase D chain-re... 167 4e-41 AT2G38570.1 | Symbols: | CONTAINS InterPro DOMAIN/s: PRC-barre... 75.0 3e-13 > AT2G38580.1 | Symbols: | Mitochondrial ATP synthase D chain-related protein | chr2:16138570-16142588 FORWARD LENGTH=1774 Length=1774 Score = 167 bits (90), Expect = 4e-41 Identities = 100/105 (95%), Gaps = 0/105 (0%) Strand=Plus/Plus Query 46 TCCGCCGATGAAAATCATATCGGAGATGGTGACGTTCCTCCAATTACCGGAGGTCCAGAT 105 |||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| Sbjct 205 TCCGTCGATGAAAATCATATCGGAGATGGTGACGTTCCTCAAATTAGCGGAGGTCCAGAT 264 Query 106 GTCGATGAGTCGCAATCATCTCATCAGATCAATGTCGTCGCAACT 150 | |||||||||||||||||||||||||||| |||||||||||||| Sbjct 265 GCCGATGAGTCGCAATCATCTCATCAGATCGATGTCGTCGCAACT 309 > AT2G38570.1 | Symbols: | CONTAINS InterPro DOMAIN/s: PRC-barrel-like (InterPro:IPR011033); Has 300 Blast hits to 300 proteins in 81 species: Archae - 0; Bacteria - 135; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). | chr2:16136689-16138886 REVERSE LENGTH=1298 Length=1298 Score = 75.0 bits (40), Expect = 3e-13 Identities = 57/64 (89%), Gaps = 5/64 (8%) Strand=Plus/Minus Query 151 TCGAGCATTGAGGA-TGGGAAGAGAGA-AGAAGAAGGAAGATGAGCAATTGCACATATCT 208 |||||||||||| | | |||||||| | |||||||||||||||||||||||||||| ||| Sbjct 200 TCGAGCATTGAGAACT-GGAAGAGA-ACAGAAGAAGGAAGATGAGCAATTGCACATTTCT 143 Query 209 TAAA 212 ||| Sbjct 142 -AAA 140 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9651407808 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5