BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg934692 Length=953 Score E Sequences producing significant alignments: (Bits) Value AT3G25460.1 | Symbols: | F-box and associated interaction doma... 52.8 6e-06 > AT3G25460.1 | Symbols: | F-box and associated interaction domains-containing protein | chr3:9231581-9232666 REVERSE LENGTH=1086 Length=1086 Score = 52.8 bits (28), Expect = 6e-06 Identities = 38/42 (90%), Gaps = 3/42 (7%) Strand=Plus/Plus Query 533 TATCAGTTGTTAAAGAAGAGAAACTTTC-G-GTT-TTGCAAC 571 |||||||||||||||||||||||||||| | ||| || |||| Sbjct 737 TATCAGTTGTTAAAGAAGAGAAACTTTCCGTGTTATTACAAC 778 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 46617288416 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5