BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg935106 Length=292 Score E Sequences producing significant alignments: (Bits) Value AT3G61260.1 | Symbols: | Remorin family protein | chr3:2267523... 73.1 1e-12 > AT3G61260.1 | Symbols: | Remorin family protein | chr3:22675238-22676788 REVERSE LENGTH=891 Length=891 Score = 73.1 bits (39), Expect = 1e-12 Identities = 48/52 (92%), Gaps = 1/52 (2%) Strand=Plus/Minus Query 88 CTTC-ATCATTGCTCTTCAATCTCCTGCTTCCTTGTGAATCGCTGCAACCTT 138 |||| ||||||||||||| ||| |||||||||||||||||||||||||||| Sbjct 631 CTTCAATCATTGCTCTTCTCTCTTCTGCTTCCTTGTGAATCGCTGCAACCTT 580 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 13471756732 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5