BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg936454 Length=586 Score E Sequences producing significant alignments: (Bits) Value AT3G27430.2 | Symbols: PBB1 | N-terminal nucleophile aminohydro... 110 2e-23 > AT3G27430.2 | Symbols: PBB1 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein | chr3:10152517-10155342 FORWARD LENGTH=1230 Length=1230 Score = 110 bits (59), Expect = 2e-23 Identities = 71/77 (92%), Gaps = 0/77 (0%) Strand=Plus/Plus Query 101 AAGATTCACTATATGGCACCAAACATATATTGCTGTGGTGCAGGAACCACTGCTGACACT 160 ||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||| Sbjct 332 AAGATTCACTATATGGCACCAAACATATATTGCTGTGGTGCAGGAACTGCGGCTGATACT 391 Query 161 GAAGCAGTAACTGGTAT 177 |||||||| |||| ||| Sbjct 392 GAAGCAGTCACTGATAT 408 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 28181356467 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5