BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg936831 Length=918 Score E Sequences producing significant alignments: (Bits) Value AT2G07827.2 | Symbols: | unknown protein; FUNCTIONS IN: molecu... 60.2 3e-08 > AT2G07827.2 | Symbols: | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:3474996-3476845 FORWARD LENGTH=540 Length=540 Score = 60.2 bits (32), Expect = 3e-08 Identities = 35/36 (97%), Gaps = 1/36 (3%) Strand=Plus/Plus Query 215 GAGAGGTGCTTTAGCAACTCGACTGAAAAGGAGAGG 250 |||||||||||||||||||||||||||| ||||||| Sbjct 453 GAGAGGTGCTTTAGCAACTCGACTGAAA-GGAGAGG 487 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 44859093271 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5