BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg936832 Length=312 Score E Sequences producing significant alignments: (Bits) Value AT2G07749.1 | Symbols: | Mitovirus RNA-dependent RNA polymeras... 56.5 1e-07 > AT2G07749.1 | Symbols: | Mitovirus RNA-dependent RNA polymerase | chr2:3247234-3249357 FORWARD LENGTH=2124 Length=2124 Score = 56.5 bits (30), Expect = 1e-07 Identities = 32/33 (97%), Gaps = 0/33 (0%) Strand=Plus/Minus Query 118 AGCGGGGAACCACCAAGTGCAGCTAAAGTAGGG 150 |||||||||||||||||||||||||||| |||| Sbjct 1369 AGCGGGGAACCACCAAGTGCAGCTAAAGCAGGG 1337 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14477111712 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5