BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg937007 Length=379 Score E Sequences producing significant alignments: (Bits) Value AT2G39320.1 | Symbols: | Cysteine proteinases superfamily prot... 126 1e-28 AT5G03330.1 | Symbols: | Cysteine proteinases superfamily prot... 95.3 4e-19 > AT2G39320.1 | Symbols: | Cysteine proteinases superfamily protein | chr2:16417477-16418517 REVERSE LENGTH=685 Length=685 Score = 126 bits (68), Expect = 1e-28 Identities = 91/102 (89%), Gaps = 2/102 (2%) Strand=Plus/Plus Query 218 GATAAAAAGTGATGGAAATTGCCAGTTCCGTGCTTTAGCTGATCAACTCTA-CAAAACCT 276 ||| |||||||||||||||||||||||||||||||| || |||||||| || ||||| | Sbjct 3 GATGAAAAGTGATGGAAATTGCCAGTTCCGTGCTTTGGCGGATCAACTTTATCAAAAT-T 61 Query 277 CGGATTGTCATAAACGTGTTAGACAAGAAATCATACAACAGA 318 ||||||||||| ||| |||||||||||||||| || |||||| Sbjct 62 CGGATTGTCATGAACTTGTTAGACAAGAAATCGTAAAACAGA 103 > AT5G03330.1 | Symbols: | Cysteine proteinases superfamily protein | chr5:806964-809779 FORWARD LENGTH=1537 Length=1537 Score = 95.3 bits (51), Expect = 4e-19 Identities = 78/91 (86%), Gaps = 2/91 (2%) Strand=Plus/Plus Query 228 GATGGAAATTGCCAGTTCCGTGCTTTAGCTGATCAACTCTACAAAACCTCGGATTGTCAT 287 ||||| |||||||||||||||||||||||||||||||| ||||||||| | ||| | ||| Sbjct 956 GATGGTAATTGCCAGTTCCGTGCTTTAGCTGATCAACTGTACAAAACCGCAGATCGCCAT 1015 Query 288 AAACGTGTTAGACAAGAAATCA-TACAACAG 317 |||| |||| ||| | |||| | || ||||| Sbjct 1016 AAACATGTTCGACGACAAAT-AGTAAAACAG 1045 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 17845050895 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5