BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg938495 Length=284 Score E Sequences producing significant alignments: (Bits) Value AT3G55566.1 | Symbols: | unknown protein; Has 30201 Blast hits... 135 2e-31 > AT3G55566.1 | Symbols: | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr3:20608742-20608840 FORWARD LENGTH=99 Length=99 Score = 135 bits (73), Expect = 2e-31 Identities = 89/97 (92%), Gaps = 0/97 (0%) Strand=Plus/Plus Query 156 ATGCTAAAAGGGTCGATGTTTGCTCATGTGGATTACAGTAATCCCGGCGACAAACCACCA 215 ||||||||||| ||| ||||||||||||||||||||| || |||||| |||| ||| ||| Sbjct 1 ATGCTAAAAGGTTCGTTGTTTGCTCATGTGGATTACACTAGTCCCGGTGACAGACCGCCA 60 Query 216 AAGAATTGGGGAAGACCACCCCATGCGCCCCAAATCT 252 |||| |||||||||||||||||||||||||||||||| Sbjct 61 AAGAGTTGGGGAAGACCACCCCATGCGCCCCAAATCT 97 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 13069614740 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5