BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg939698 Length=280 Score E Sequences producing significant alignments: (Bits) Value AT5G03204.1 | Symbols: | unknown protein; Has 30201 Blast hits... 183 5e-46 > AT5G03204.1 | Symbols: | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:762287-762397 REVERSE LENGTH=111 Length=111 Score = 183 bits (99), Expect = 5e-46 Identities = 107/111 (96%), Gaps = 0/111 (0%) Strand=Plus/Plus Query 150 ATGGCGAGGATGATCGGACCATTCGAAACTGTACCGGCGATTCTTGTTTATCCGGTGAGG 209 ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 1 ATGGCTAGGATGATCGGACCATTCGAAACTGTACCGGCGATTCTTGTTTATCCGATGAGG 60 Query 210 GTTTCAGCTTCGCCATCGCTGGGGACAATTTATGAGGAAGACGATGAGTAA 260 |||||||||||||| |||||||||||||||||||||||| ||||||||||| Sbjct 61 GTTTCAGCTTCGCCTTCGCTGGGGACAATTTATGAGGAACACGATGAGTAA 111 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12868543744 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5