BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg940863 Length=321 Score E Sequences producing significant alignments: (Bits) Value ATMG00090.1 | Symbols: | structural constituent of ribosome;pr... 71.3 5e-12 ATMG01390.1 | Symbols: RRN18 | Mitochondrial 18S ribosomal RNA,... 60.2 1e-08 > ATMG00090.1 | Symbols: | structural constituent of ribosome;protein binding | chrM:25482-28733 REVERSE LENGTH=1671 Length=1671 Score = 71.3 bits (38), Expect = 5e-12 Identities = 40/41 (98%), Gaps = 0/41 (0%) Strand=Plus/Plus Query 54 GAACGATCTTCGCTTCGCGGGAACAACTAAAACCACCATCT 94 ||| ||||||||||||||||||||||||||||||||||||| Sbjct 951 GAATGATCTTCGCTTCGCGGGAACAACTAAAACCACCATCT 991 > ATMG01390.1 | Symbols: RRN18 | Mitochondrial 18S ribosomal RNA, which is a component of the 30S small subunit of mitochondrial ribosome. The rRNA is degraded by a polynucleotide phosphorylase-like protein (AtmtPNPase). | chrM:361350-363284 REVERSE LENGTH=1935 Length=1935 Score = 60.2 bits (32), Expect = 1e-08 Identities = 32/32 (100%), Gaps = 0/32 (0%) Strand=Plus/Plus Query 26 GTCTCGCCCAGGAGGCGGGAAGAGTTGAGAAC 57 |||||||||||||||||||||||||||||||| Sbjct 131 GTCTCGCCCAGGAGGCGGGAAGAGTTGAGAAC 162 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14929521453 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5