BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg940915 Length=258 Score E Sequences producing significant alignments: (Bits) Value AT5G14400.1 | Symbols: CYP724A1 | cytochrome P450, family 724, ... 159 8e-39 > AT5G14400.1 | Symbols: CYP724A1 | cytochrome P450, family 724, subfamily A, polypeptide 1 | chr5:4643521-4646382 FORWARD LENGTH=1263 Length=1263 Score = 159 bits (86), Expect = 8e-39 Identities = 90/92 (98%), Gaps = 0/92 (0%) Strand=Plus/Plus Query 145 GGATGGCCTTTCGTTGGAGAAACTATTTCTTTCTTCAAACCTCATAGATCAGACTCCATC 204 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 GGATGGCCTTTCATTGGAGAAACTATTTCTTTCTTCAAACCTCATAGATCAGACTCCATC 60 Query 205 GGCACATTCTTGCAACAACGTGTTTCACGGTA 236 || ||||||||||||||||||||||||||||| Sbjct 61 GGTACATTCTTGCAACAACGTGTTTCACGGTA 92 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 11762653266 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5