BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg942001 Length=318 Score E Sequences producing significant alignments: (Bits) Value AT5G24470.1 | Symbols: APRR5, PRR5 | pseudo-response regulator ... 213 8e-55 > AT5G24470.1 | Symbols: APRR5, PRR5 | pseudo-response regulator 5 | chr5:8355951-8358873 REVERSE LENGTH=2257 Length=2257 Score = 213 bits (115), Expect = 8e-55 Identities = 172/198 (87%), Gaps = 10/198 (5%) Strand=Plus/Plus Query 124 ATGTGGCAAACGTGGCCACGTCAGCCAATTCTACTAGATATTTTT-CAAACCCCTTTACC 182 ||||||||||||||||||||||||||||||||||||||||||||| |||| || ||| Sbjct 1 ATGTGGCAAACGTGGCCACGTCAGCCAATTCTACTAGATATTTTTTCAAATCCAAATACT 60 Query 183 CTTTTCACAACCGTTAGATCAAGGTCGGTTCACCGCCCAAATCCAATC-TCAACCGTTAA 241 |||| |||||||||||||||| ||||||||| || |||| | ||||| | ||||||||| Sbjct 61 CTTTCCACAACCGTTAGATCATGGTCGGTTCGCCACCCACTTTCAATCAT-AACCGTTAA 119 Query 242 AACATTCGCTAGATTTTTTCTAGATAtttttttttCCCTCACAATAATTTTATAGAA-GA 300 |||||||||||||||||||||||||||||| ||||| | |||| || || |||||| || Sbjct 120 AACATTCGCTAGATTTTTTCTAGATATTTTCTTTTCTC-CACACTA-TT--ATAGAAAGA 175 Query 301 ATAAAGA-CTTTTATTTT 317 |||||| ||||| |||| Sbjct 176 ATAAAGTTCTTTT-TTTT 192 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14778718206 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5