BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg943059 Length=193 Score E Sequences producing significant alignments: (Bits) Value AT4G11740.1 | Symbols: SAY1 | Ubiquitin-like superfamily protei... 73.1 8e-13 > AT4G11740.1 | Symbols: SAY1 | Ubiquitin-like superfamily protein | chr4:7071860-7075501 FORWARD LENGTH=2035 Length=2035 Score = 73.1 bits (39), Expect = 8e-13 Identities = 39/39 (100%), Gaps = 0/39 (0%) Strand=Plus/Plus Query 155 TTGGAGATGGGGAAAGTGAGTCGACCTTAAACGATCTTG 193 ||||||||||||||||||||||||||||||||||||||| Sbjct 1708 TTGGAGATGGGGAAAGTGAGTCGACCTTAAACGATCTTG 1746 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 8551229670 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5