BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg944025 Length=406 Score E Sequences producing significant alignments: (Bits) Value AT4G39952.1 | Symbols: | Pentatricopeptide repeat (PPR) superf... 152 2e-36 > AT4G39952.1 | Symbols: | Pentatricopeptide repeat (PPR) superfamily protein | chr4:18527680-18530007 FORWARD LENGTH=2328 Length=2328 Score = 152 bits (82), Expect = 2e-36 Identities = 99/106 (93%), Gaps = 5/106 (5%) Strand=Plus/Plus Query 39 CGTCGTCTCTTGAAACCCAAAT-TTGTTGTTACTCTACGAACAATCTCATCTTCTTCTTC 97 |||||||||||||||||| ||| |||||||||||||||| ||| ||| ||||||||||| Sbjct 7 CGTCGTCTCTTGAAACCC-AATCTTGTTGTTACTCTACG--CAAACTC-TCTTCTTCTTC 62 Query 98 CTCAAGCTACGTCGATCGTCATATTAGTGTGATTCTCTGCGATCAG 143 | |||||||||||||||||||||||||||||||||||||||||||| Sbjct 63 CGCAAGCTACGTCGATCGTCATATTAGTGTGATTCTCTGCGATCAG 108 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 19202280118 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5