BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg944383 Length=1106 Score E Sequences producing significant alignments: (Bits) Value AT4G35120.1 | Symbols: | Galactose oxidase/kelch repeat superf... 86.1 7e-16 > AT4G35120.1 | Symbols: | Galactose oxidase/kelch repeat superfamily protein | chr4:16716806-16718017 FORWARD LENGTH=1170 Length=1170 Score = 86.1 bits (46), Expect = 7e-16 Identities = 76/90 (84%), Gaps = 4/90 (4%) Strand=Plus/Plus Query 924 GGGTTT-GAGTGATCTGTA-TATGAAGCGTGCTAGTAATTACCGCACGATTCAATTAGTT 981 |||||| || || ||| || || ||||||| | || ||||| |||||||| |||||| Sbjct 882 GGGTTTGGA-TGTTCTATACGAT-AAGCGTGGTTGTGGCTACCGTACGATTCAGTTAGTT 939 Query 982 AACTATGGTGGGAAACTGTTAATTATATGG 1011 |||||||||||||||||||||||||||||| Sbjct 940 AACTATGGTGGGAAACTGTTAATTATATGG 969 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 54216588600 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5