BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg944776 Length=374 Score E Sequences producing significant alignments: (Bits) Value AT2G40090.1 | Symbols: ATATH9, ATH9 | ABC2 homolog 9 | chr2:167... 104 6e-22 > AT2G40090.1 | Symbols: ATATH9, ATH9 | ABC2 homolog 9 | chr2:16737466-16740370 REVERSE LENGTH=1903 Length=1903 Score = 104 bits (56), Expect = 6e-22 Identities = 74/82 (90%), Gaps = 4/82 (5%) Strand=Plus/Minus Query 1 GATTTCGGAGAAATACTGTGATGCATACATATGTAGCTCTGATACATCTTCTTTGTTGCC 60 |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 1399 GATTTCGGAGAAGTACTGTGATGCATACATCTGTAGCTCTGATACATCTTCTTTGTTGCC 1340 Query 61 --GC--GACTTAATGATCCACA 78 | |||| ||||||||||| Sbjct 1339 TTGGATGACTAAATGATCCACA 1318 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 17593712150 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5