BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg945355 Length=385 Score E Sequences producing significant alignments: (Bits) Value AT2G32920.1 | Symbols: ATPDIL2-3, PDI9, ATPDI9, PDIL2-3 | PDI-l... 78.7 4e-14 > AT2G32920.1 | Symbols: ATPDIL2-3, PDI9, ATPDI9, PDIL2-3 | PDI-like 2-3 | chr2:13962318-13965472 REVERSE LENGTH=1573 Length=1573 Score = 78.7 bits (42), Expect = 4e-14 Identities = 46/48 (96%), Gaps = 0/48 (0%) Strand=Plus/Minus Query 154 ACCATGGTGCAAAGAACTCTACCAAAACAAATCCATTAGAATTAAGAA 201 |||||||||||||||||||||||||||||| |||||| |||||||||| Sbjct 244 ACCATGGTGCAAAGAACTCTACCAAAACAACTCCATTTGAATTAAGAA 197 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 18146657389 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5