BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg945396 Length=226 Score E Sequences producing significant alignments: (Bits) Value AT4G26670.1 | Symbols: | Mitochondrial import inner membrane t... 108 3e-23 > AT4G26670.1 | Symbols: | Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein | chr4:13452117-13453984 FORWARD LENGTH=1178 Length=1178 Score = 108 bits (58), Expect = 3e-23 Identities = 67/71 (94%), Gaps = 1/71 (1%) Strand=Plus/Minus Query 157 CCCGTAATGATTTTGTCAAAGAACGCCTCCGGCAGAAACAAGGCAAGTGATTTCAGATTC 216 ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 1178 CCCGTAATGATTTTGTCAAAGAACGCCTCAGGCAGAAACAAGGCAAGTGATTTCAGATTT 1119 Query 217 ACAT-GATATT 226 |||| || ||| Sbjct 1118 ACATTGAGATT 1108 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 10154085298 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5