BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg946222 Length=748 Score E Sequences producing significant alignments: (Bits) Value AT4G19570.1 | Symbols: | Chaperone DnaJ-domain superfamily pro... 67.6 2e-10 > AT4G19570.1 | Symbols: | Chaperone DnaJ-domain superfamily protein | chr4:10665294-10667318 FORWARD LENGTH=1892 Length=1892 Score = 67.6 bits (36), Expect = 2e-10 Identities = 40/42 (95%), Gaps = 0/42 (0%) Strand=Plus/Plus Query 702 GATGACAACAGGAAATGCAAACTCTAATCTTGACGCACAGAG 743 ||||||||||||||||||||||||||||||||| || ||||| Sbjct 1673 GATGACAACAGGAAATGCAAACTCTAATCTTGAAGCGCAGAG 1714 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 36319288281 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5