BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg946752 Length=1262 Score E Sequences producing significant alignments: (Bits) Value AT3G27600.1 | Symbols: | SWAP (Suppressor-of-White-APricot)/su... 108 2e-22 > AT3G27600.1 | Symbols: | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein | chr3:10223743-10224948 REVERSE LENGTH=942 Length=942 Score = 108 bits (58), Expect = 2e-22 Identities = 135/171 (79%), Gaps = 10/171 (6%) Strand=Plus/Plus Query 1057 ATTGAGATCACAGTGCAGTCGTTATCGGAAAACGTGGCGAGTTTCAAGGAGAAAATAGCT 1116 ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 685 ATTGAGAAAACAGTGCAGTCGTTATCTGAAAACGTGGCGAGTTTCAAGGAGAAAATAGCC 744 Query 1117 GAGGAGATTC--AA-ATTCC-AGCAAACACACACAAGTTA-AGT-GGAAAAGCAGGGGTT 1170 | ||| | | || | ||| | || | | | || || | | | |||||| | ||| || Sbjct 745 GCGGATAAACCGAAGAATCCCACCAGAGA-AG-CAGGTGATATTCGGAAAATCCGGG-TT 801 Query 1171 -TTAGACGACGACAACAAGTCACTTGCACATTACAATGTTGGAGTAGGAGA 1220 ||| | ||| ||||||||||||| ||| |||| ||||| |||| |||||| Sbjct 802 GTTAAAGGACAACAACAAGTCACTAGCATATTAAAATGTAGGAGCAGGAGA 852 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 62047873620 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5