BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg947576 Length=324 Score E Sequences producing significant alignments: (Bits) Value AT4G34060.1 | Symbols: DML3 | demeter-like protein 3 | chr4:163... 86.1 2e-16 > AT4G34060.1 | Symbols: DML3 | demeter-like protein 3 | chr4:16314003-16319426 FORWARD LENGTH=3308 Length=3308 Score = 86.1 bits (46), Expect = 2e-16 Identities = 58/64 (91%), Gaps = 0/64 (0%) Strand=Plus/Plus Query 42 AATGGAACATACTTCCAAACCAATGAGGTTTTTGCTGATCATGACTCTAGCATCAACCCA 101 |||||||||||||||||||||||||||||||||||||||||||| | ||| | ||||| Sbjct 2837 AATGGAACATACTTCCAAACCAATGAGGTTTTTGCTGATCATGAGACAAGCTTAAACCCC 2896 Query 102 ATTG 105 |||| Sbjct 2897 ATTG 2900 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 15080324700 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5