BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg947699 Length=200 Score E Sequences producing significant alignments: (Bits) Value AT5G40480.1 | Symbols: EMB3012 | embryo defective 3012 | chr5:1... 84.2 4e-16 > AT5G40480.1 | Symbols: EMB3012 | embryo defective 3012 | chr5:16213222-16224058 FORWARD LENGTH=5987 Length=5987 Score = 84.2 bits (45), Expect = 4e-16 Identities = 53/57 (93%), Gaps = 0/57 (0%) Strand=Plus/Plus Query 89 GCCACTACTCAACTCTGCTTCCACAAGGTTCTGAAAATACTCTCACCGATGATGTAC 145 |||| ||||||||||||||||||||||||||||||| ||||||||| |||| ||||| Sbjct 2907 GCCAATACTCAACTCTGCTTCCACAAGGTTCTGAAAGTACTCTCACTGATGCTGTAC 2963 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 8903339127 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5