BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg948373 Length=205 Score E Sequences producing significant alignments: (Bits) Value AT1G07700.3 | Symbols: | Thioredoxin superfamily protein | chr... 154 3e-37 > AT1G07700.3 | Symbols: | Thioredoxin superfamily protein | chr1:2379647-2381362 FORWARD LENGTH=1539 Length=1539 Score = 154 bits (83), Expect = 3e-37 Identities = 83/83 (100%), Gaps = 0/83 (0%) Strand=Plus/Plus Query 89 AGCTCCTGTTATCTTCCTTAAGCATAATGTGGTAGATGAATATGATGAACAATCTGAAGT 148 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1109 AGCTCCTGTTATCTTCCTTAAGCATAATGTGGTAGATGAATATGATGAACAATCTGAAGT 1168 Query 149 CGCAGAAAGGCTCCGTATCAAGG 171 ||||||||||||||||||||||| Sbjct 1169 CGCAGAAAGGCTCCGTATCAAGG 1191 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9154845882 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5