BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg948509 Length=197 Score E Sequences producing significant alignments: (Bits) Value AT3G42190.1 | Symbols: | transposable element gene | chr3:1436... 99.0 1e-20 AT3G18900.2 | Symbols: | FUNCTIONS IN: molecular_function unkn... 56.5 8e-08 AT3G49980.1 | Symbols: | F-box and associated interaction doma... 56.5 8e-08 AT3G20690.1 | Symbols: | F-box and associated interaction doma... 56.5 8e-08 > AT3G42190.1 | Symbols: | transposable element gene | chr3:14364926-14371068 FORWARD LENGTH=2088 Length=2088 Score = 99.0 bits (53), Expect = 1e-20 Identities = 57/59 (97%), Gaps = 0/59 (0%) Strand=Plus/Plus Query 52 ATGGCTCATGCAAGGTTCTTGATGAAAGCGGCAATATCGACTATGACTCGCTTGGTAAA 110 ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| Sbjct 1 ATGGCTCATGCAAGGTTCTTGATGAAAGCGGCAATATCGACAATGACTTGCTTGGTAAA 59 > AT3G18900.2 | Symbols: | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: synergid; CONTAINS InterPro DOMAIN/s: F-box associated domain, type 1 (InterPro:IPR006527), F-box associated interaction domain (InterPro:IPR017451), Protein of unknown function DUF547 (InterPro:IPR006869); BEST Arabidopsis thaliana protein match is: Protein of unknown function, DUF547 (TAIR:AT5G66600.3). | chr3:6517181-6521019 FORWARD LENGTH=2500 Length=2500 Score = 56.5 bits (30), Expect = 8e-08 Identities = 30/30 (100%), Gaps = 0/30 (0%) Strand=Plus/Plus Query 112 GTGTGTCTTTGAAGGGAAATACTTACTGGT 141 |||||||||||||||||||||||||||||| Sbjct 1817 GTGTGTCTTTGAAGGGAAATACTTACTGGT 1846 > AT3G49980.1 | Symbols: | F-box and associated interaction domains-containing protein | chr3:18530329-18531477 REVERSE LENGTH=1149 Length=1149 Score = 56.5 bits (30), Expect = 8e-08 Identities = 32/33 (97%), Gaps = 0/33 (0%) Strand=Plus/Plus Query 114 GTGTCTTTGAAGGGAAATACTTACTGGTGTGCT 146 |||||||||||||||||||||||||||| |||| Sbjct 610 GTGTCTTTGAAGGGAAATACTTACTGGTTTGCT 642 > AT3G20690.1 | Symbols: | F-box and associated interaction domains-containing protein | chr3:7231570-7232682 REVERSE LENGTH=1113 Length=1113 Score = 56.5 bits (30), Expect = 8e-08 Identities = 32/33 (97%), Gaps = 0/33 (0%) Strand=Plus/Plus Query 114 GTGTCTTTGAAGGGAAATACTTACTGGTGTGCT 146 |||||||||||||||||||||||||||| |||| Sbjct 613 GTGTCTTTGAAGGGAAATACTTACTGGTATGCT 645 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 8752435074 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5