BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg948829 Length=190 Score E Sequences producing significant alignments: (Bits) Value AT2G17790.1 | Symbols: VPS35A, ZIP3 | VPS35 homolog A | chr2:77... 73.1 8e-13 > AT2G17790.1 | Symbols: VPS35A, ZIP3 | VPS35 homolog A | chr2:7733635-7739673 FORWARD LENGTH=2743 Length=2743 Score = 73.1 bits (39), Expect = 8e-13 Identities = 45/48 (94%), Gaps = 0/48 (0%) Strand=Plus/Plus Query 7 AGACAGAGCAGAAGATGAAGAGAAATGGCTCGCCGCCAGTGCTGCTGC 54 |||| || ||||||||||||||||||||||||||||| |||||||||| Sbjct 59 AGACGGATCAGAAGATGAAGAGAAATGGCTCGCCGCCGGTGCTGCTGC 106 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 8400325617 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5