BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg948849 Length=305 Score E Sequences producing significant alignments: (Bits) Value AT5G62910.1 | Symbols: | RING/U-box superfamily protein | chr5... 75.0 4e-13 AT1G63260.1 | Symbols: TET10 | tetraspanin10 | chr1:23466800-23... 58.4 4e-08 > AT5G62910.1 | Symbols: | RING/U-box superfamily protein | chr5:25250256-25252236 FORWARD LENGTH=1543 Length=1543 Score = 75.0 bits (40), Expect = 4e-13 Identities = 40/40 (100%), Gaps = 0/40 (0%) Strand=Plus/Plus Query 17 TAAGATGAAGCAGAACAAGCTTGGTCTCCGTCGTGAGCAA 56 |||||||||||||||||||||||||||||||||||||||| Sbjct 422 TAAGATGAAGCAGAACAAGCTTGGTCTCCGTCGTGAGCAA 461 > AT1G63260.1 | Symbols: TET10 | tetraspanin10 | chr1:23466800-23469204 REVERSE LENGTH=1419 Length=1419 Score = 58.4 bits (31), Expect = 4e-08 Identities = 31/31 (100%), Gaps = 0/31 (0%) Strand=Plus/Plus Query 148 TTATAGCTCTTGGTGGTTTCATCTTCTTGAT 178 ||||||||||||||||||||||||||||||| Sbjct 396 TTATAGCTCTTGGTGGTTTCATCTTCTTGAT 426 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14125237469 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5