BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg949822 Length=1076 Score E Sequences producing significant alignments: (Bits) Value AT4G20095.3 | Symbols: | Protein of unknown function (DUF626) ... 62.1 1e-08 > AT4G20095.3 | Symbols: | Protein of unknown function (DUF626) | chr4:10871643-10873615 REVERSE LENGTH=1152 Length=1152 Score = 62.1 bits (33), Expect = 1e-08 Identities = 37/39 (95%), Gaps = 0/39 (0%) Strand=Plus/Plus Query 414 CTCTTTGGTAAAGTTGGACTTCATTGCTACAATCTGCAA 452 ||||| |||| |||||||||||||||||||||||||||| Sbjct 402 CTCTTCGGTAGAGTTGGACTTCATTGCTACAATCTGCAA 440 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 52710572250 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5