BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg950105 Length=317 Score E Sequences producing significant alignments: (Bits) Value AT5G54570.1 | Symbols: BGLU41 | beta glucosidase 41 | chr5:2216... 124 4e-28 > AT5G54570.1 | Symbols: BGLU41 | beta glucosidase 41 | chr5:22167636-22170235 REVERSE LENGTH=1608 Length=1608 Score = 124 bits (67), Expect = 4e-28 Identities = 73/76 (96%), Gaps = 0/76 (0%) Strand=Plus/Plus Query 72 AATGACATAGACCTGCTGAAAGATCTGAGAATGGATGCTTACAGATTCTCGATATCTTGG 131 ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| Sbjct 277 AATGACATAGACCTGATGAAAGATCTGAGAATGGATGCTTACAGATTCTCTATATCTTGG 336 Query 132 TCAAGAATATTCACTA 147 |||||||||||| ||| Sbjct 337 TCAAGAATATTCCCTA 352 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14728450457 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5