BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg950981 Length=280 Score E Sequences producing significant alignments: (Bits) Value AT1G77500.1 | Symbols: | Protein of unknown function (DUF630 a... 185 2e-46 > AT1G77500.1 | Symbols: | Protein of unknown function (DUF630 and DUF632) | chr1:29121489-29125191 FORWARD LENGTH=3158 Length=3158 Score = 185 bits (100), Expect = 2e-46 Identities = 114/121 (94%), Gaps = 0/121 (0%) Strand=Plus/Plus Query 130 GGATCATGTATCTAGTAGCACCATCTACACGGTCATCGCACTCTCGGCCCAGACTATCAA 189 ||||||||||||| ||||||||||| ||||||||||||||||||| |||||||||||||| Sbjct 1751 GGATCATGTATCTGGTAGCACCATCCACACGGTCATCGCACTCTCAGCCCAGACTATCAA 1810 Query 190 TACGTTTAACATCTAGGACACGGAAAATGGCGAAAGCATACAATGGACAAGATGTTAATG 249 |||||||||||||||| || || |||||||||||| |||||||||||||||||||||||| Sbjct 1811 TACGTTTAACATCTAGAACTCGAAAAATGGCGAAATCATACAATGGACAAGATGTTAATG 1870 Query 250 G 250 | Sbjct 1871 G 1871 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12868543744 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5